.. _sequences: ******************************* Sequences and FASTA/FASTQ files ******************************* .. currentmodule:: HTSeq .. doctest:: :hide: >>> import HTSeq ``Sequence`` ============ A **Sequence** object holds a DNA sequence. Besides the actual sequence, an object may also hold a name. Instantiation .. class:: Sequence(seq, name="unnamed") Pass the DNA sequence and, optionally, a name or ID to the constructor:: >>> myseq = HTSeq.Sequence(b"ACCGTTAC", "my_sequence") (If the name is omitted, the default ``"unnamed"`` is used.) Attributes .. attribute:: Sequence.seq Sequence.name Sequence.descr The information can be accessed via the attributes **seq** and **name**, which are strings:: >>> myseq.seq b'ACCGTTAC' >>> myseq.name 'my_sequence' There is a third attribute, called **descr**, which is by default ``None`` but may contain a "description". See class :class:`FastaReader` for more information. Representation and string conversion The **__repr__** method gives name and length:: >>> myseq The **__str__** method returns just the sequence: >>> print(myseq) ACCGTTAC Note that the length of a sequence is the number of bases:: >>> len(myseq) 8 Subsetting Subsetting works as with strings:: >>> myseq2 = myseq[3:5] >>> myseq2.name 'my_sequence[part]' >>> myseq2.seq b'GT' (Note that ``"[part]"`` is appended to the name of the subsetted copy.) Reverse complement .. method:: Sequence.get_reverse_complement() :: >>> print(myseq.get_reverse_complement()) GTAACGGT >>> rc = myseq.get_reverse_complement() >>> rc.name 'revcomp_of_my_sequence' >>> rc.seq b'GTAACGGT' Writing to FASTA file .. method: Sequence.write_to_fasta_file(fasta_file) To write **Sequence** objects into a FASTA file, open a text file for writing, then call **write_to_fasta_file** for each sequence, providing the open file handle as only argument, and close the file:: >>> my_fasta_file = open("test.fa", "w") >>> myseq.write_to_fasta_file(my_fasta_file) >>> my_fasta_file.close() To read from a FASTA file, see class :class:`FastaReader`. Extended UIPAC letters These are not (yet) supported. A sequence should only contain A, C, G, T and N. Counting bases .. method: Sequence.add_bases_to_count_array(count_array) For read quality assessment, it is often helpful to count the proportions of called bases, stratified by position in the read. To obtain such counts, the following idiom is helpful: .. doctest:: >>> import numpy >>> reads = HTSeq.FastqReader("yeast_RNASeq_excerpt_sequence.txt") >>> counts = numpy.zeros((36, 5), int) >>> for read in reads: ... read.add_bases_to_count_array(counts) >>> counts #doctest:+NORMALIZE_WHITESPACE,+ELLIPSIS array([[16194, 2048, 4017, 2683, 57], [10716, 3321, 4933, 6029, 0], [ 7816, 5024, 5946, 6213, 0], ... [ 8526, 4812, 5460, 6197, 4], [ 8088, 4915, 5531, 6464, 1]]) Here, a two-dimensional numpy array of integer zeroes is defined and then passed to the **add_bases_to_count_array** method of each Sequence object obtained from the Fastq file. The method *add_bases_to_count_array* adds, for each base, a one to one of the array elements such that, in the end, the 36 rows of the array correspond to the positions in the reads (all of length 36 bp in this example), and the 5 columns correspond to the base letters 'A', 'C', 'G', 'T', and 'N', as given by the constant **base_to_columns** .. data:: base_to_column = {'A': 0, 'C': 1, 'G': 2, 'T': 3, 'N': 4} Hence, we can get the proportion of 'C's in each position as follows: .. doctest:: >>> counts = numpy.array(counts, float) #doctest:+ELLIPSIS,+NORMALIZE_WHITESPACE >>> #counts[:, HTSeq.base_to_column['C']] / counts.sum(1) array([ 0.08192328, 0.13284531, 0.20096804, 0.16872675, 0.21200848, ... 0.18560742, 0.19236769, 0.19088764, 0.17872715, 0.1924877 , 0.19660786]) (Here, we first convert the count array to type ``float`` to allow to proper division, and then divide the second column (``HTSeq.base_to_column['C']``) by the row-wise sums (``counts.sum(1)``; the ``1`` requests summing along rows).) Trimming reads .. method:: Sequence.trim_left_end(pattern, mismatch_prop = 0.) Sequence.trim_right_end(pattern, mismatch_prop = 0.) In high-throughput sequencing, reads are sometimes contaminated with adapters or sequencing primers. These function take a pattern and attempt to match either the right end of the pattern to the left end of the sequence (``trim_left_end``) or the left end of the pattern to the right end of the sequence (``trim_right_end``). The match is the trimmed off. Here is an example:: >>> seq2 = HTSeq.Sequence(b"ACGTAAAGCGGTACGGGGGG") >>> left_seq = HTSeq.Sequence(b"CCCACG") >>> print(seq2.trim_left_end(left_seq)) TAAAGCGGTACGGGGGG The right end of the pattern ("ACG") matched the left end of the sequence, and has hence been trimmed off. The optional argument ``mismatch_prop`` is the number of allowed mismatches as proportion of the length of the match:: >>> right_seq = HTSeq.Sequence(b"GGGTGGG") >>> print(seq2.trim_right_end(right_seq)) ACGTAAAGCGGTACGGG >>> print(seq2.trim_right_end(right_seq, 1/6.)) ACGTAAAGCGGTAC >>> print(seq2.trim_right_end(right_seq, 1/7.)) ACGTAAAGCGGTACGGG Here, if we allow at least one mismatch per six bases, the whole pattern gets cut off. If you have quality information, you can use this, too, to specify the allowed amount of mismatch. See :meth:`SequenceWithQualities.trim_left_end_with_quals` and :meth:`SequenceWithQualities.trim_left_end_with_quals`. ``SequenceWithQualities`` ========================= The sequences obtained from high-throughput sequencing devices (in the following also referred to as "reads") typically come with `base-call quality scores`, which indicate how sure the software was that the right base was called. The class ``SequenceWithQualities`` represents such reads. ``SequenceWithQualities`` is a daughter class of :class:`Sequence` and inherits all its features. Instantiation .. class:: SequenceWithQualities(seq, name qualstr, qualscale="phred") A ``SequenceWithQualities`` can be instantiated as a ``Sequence``, but now with a third argument, the quality string:: >>> myread = HTSeq.SequenceWithQualities(b"ACGACTGACC", "my_read", b"IICGAB##(!") The quality string is interpreted as Sanger-encoded string of Phred values, as defined in the `FASTQ format specification`_, i.e., each letter in the quality string corresponds to one base in the sequence and if the value 33 is subtracted from the quality characters ASCII value, the Phred score is obtained. The Phred scores can then be found in the slot ``qual``:: >>> myread.qualstr b'IICGAB##(!' >>> myread.qual array([40, 40, 34, 38, 32, 33, 2, 2, 7, 0], dtype=uint8) If the quality string follows the `Solexa FASTQ` specification, the value to be subtracted is not 33 but 64. If you pass a quality string in this format, set ``qualscale="solexa"``. Prior to version 1.3, the SolexaPipeline software used a yet another style of encoding quality string. If you want to use this one, specify ``qualscale="solexa-old"`` .. _`FASTQ format specification`: http://maq.sourceforge.net/fastq.shtml Attributes As for ``Sequence`` objects, there are attributes ``name``, ``seq``, and ``descr``. Furthermore, we now have the attributes ``qual`` and ``qualstr``, already mentioned above. .. attribute:: SequenceWithQuality.qual ``qual`` is a ``numpy`` array of data type *integer*, with as many elements as there are bases. Each element is a `Phred score`. A Phred score *S* is defined to mean that the base caller estimates the probability *p* of the base call being wrong as *p* = -log10 ( *S*/10 ). Note that ``qual`` is always the probability, even if the ``solexa-old`` quality string format has been used, which encodes the odds *p* ( 1 - *p* ), i.e., in that case, the odds are converted to probabilities. .. attribute:: SequenceWithQuality.qualstr The quality string according to Sanger Phred encoding. In case the quality was originally given in ``solexa`` or ``solexa-old`` format, it is converted:: >>> read2 = HTSeq.SequenceWithQualities(b"ACGACTGACC", "my_read", b"hhgddaZVFF", "solexa") >>> read2.qual array([40, 40, 39, 36, 36, 33, 26, 22, 6, 6], dtype=uint8) >>> read2.qualstr b"IIHEEB;7''" Writing to FASTQ file .. method:: SequenceWithQuality.write_to_fastq_file(fasta_file) To write ``SequenceWithQualities`` objects into a FASTQ file, open a text file for writing, then call ``write_to_fastq_file`` for each sequence, providing the open file handle as only argument, and close the file:: >>> my_fastq_file = open("test.fq", "w") >>> myread.write_to_fastq_file(my_fastq_file) >>> my_fastq_file.close() Note that the reads will always be written with quality strings in Sanger encoding. To read from a FASTQ file, see class :class:`FastqReader`. Counting quality values .. method: Sequence.add_qual_to_count_array(count_array) Similar to :meth:`Sequence.add_bases_to_count_array`, this method counts the occuring quality values stratified by position. This then allows to calculate average qualities as well as histograms. Here is a usage example: .. doctest:: >>> import numpy #doctest:+NORMALIZE_WHITESPACE,+ELLIPSIS >>> reads = HTSeq.FastqReader("yeast_RNASeq_excerpt_sequence.txt", "solexa") >>> counts = numpy.zeros((36, 41), int) >>> for read in reads: ... read.add_qual_to_count_array(counts) >>> #counts array([[ 0, 0, 64, ..., 0, 0, 0], [ 0, 0, 93, ..., 0, 0, 0], ..., [ 0, 0, 2445, ..., 0, 0, 0], [ 0, 0, 2920, ..., 0, 0, 0]]) The value ``counts[i,j]`` is then the number of reads for which the base at position ``i`` hat the quality scores ``j``. According to the Fastq standard, quality scores range from 0 to 40; hence, the array is initialized to have 41 columns. Trimming reads .. method:: SequenceWithQualities.trim_left_end_with_quals(pattern, max_mm_qual = 5) SequenceWithQualities.trim_right_end_with_quals(pattern, max_mm_qual = 5) These methods work as :meth:`Sequence.trim_left_end` and :meth:`Sequence.trim_right_end` (which are, of course, avilable for ``SequenceWithQualities`` objects, too). The difference is, that for the ``_with_quals`` trimming methods, the maximum amount of allowed mismatch is specified as the maximum value that the sum of the quality scores of the mismatched bases may take. *TODO*: Add example ``FastaReader`` =============== The FastaReader class allows to read and parse a FASTA file. It can generates an iterator of ``Sequence`` objects or a faster, simpler iterator of string tuples. .. class:: FastaReader(filename_or_sequence, raw_iterator=False) As daughter class of ``FileOrSequence``, ``FastaReader`` can be instantiated with either a filename, or with a list of sequences. See :class:`FileOrSequence` for details. Example 1 The typical use for FastaReader is to go through a FASTA file and do something with each sequence, e.g.:: >>> for s in HTSeq.FastaReader("fastaEx.fa"): ... print("Sequence '%s' has length %d." % (s.name, len(s))) Sequence 'sequence1' has length 72. Sequence 'sequence2' has length 70. Example 2 Often, one might to read a whole Fasta file into memory to access it as a dict. This is a good idiom for this purpose:: >>> sequences = dict((s.name, s) for s in HTSeq.FastaReader("fastaEx.fa")) >>> sequences["sequence1"].seq b'AGTACGTAGTCGCTGCTGCTACGGGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTAAACGATGC' Example 3 One can use ``raw_iterator=True`` to maximize parsing speed at the expense of not getting a nice ``Sequence`` instance but rather only a tuple:: >>> sequences = dict((s[1], s[0]) for s in HTSeq.FastaReader("fastaEx.fa", raw_iterator=True)) >>> sequences["sequence1"] 'AGTACGTAGTCGCTGCTGCTACGGGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTAAACGATGC' ``FastqReader`` =============== The **FastqReader** class works similar to :class:`FastaReader`. It reads a Fastq file and generates an iterator over :class:`SequenceWithQualities` objects or a faster, simpler iterator of tuples. .. class:: FastqReader(filename_or_sequence, qual_scale="phred", raw_iterator=False) As daughter class of ``FileOrSequence``, ``FastaReader`` can be instantiated with either a filename, or with a sequence. See :class:`FileOrSequence` for details. By default, the quality strings are assumed to be encoded according to the Sanger/Phred standard. You may alternatively specify ``"solexa"`` or ``"solexa-old"`` (see :class:`SequenceWithQuality`).